Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: LNP characterization and THP1 activation. LNPs were prepared using OVA mRNA, GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Activation Assay, Standard Deviation, Fluorescence, Flow Cytometry, Expressing

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: cGAS∆N-LNPs induce human moDC activation. Human moDCs were cultured for 24 hours in the presence of cGAS∆N-LNPs (0.2 µg/mL mRNA in well), GFP-LNPs (0.2 µg/mL mRNA in well), or OVA-LNPs (1.0 µg/mL mRNA in well). ( A ) IL-6, ( B ) IP-10, ( C ) and IFNβ secretion were assessed using a multiplex cytokine bead array. Data on graphs represent the average of a triplicate for each of the four donors. Error bars show the standard deviation between donor cytokine secretion. ( D ) cGAMP production was quantified from cell lysates following LNP treatments. Data represent means and SD of a triplicate from one donor. Data are representative of at least two donors. ( E–H ) MoDCs were cultured in the presence of cGAS∆N-LNPs with or without pre-treatment with TBK1 inhibitor or STING inhibitor for 24 hours. ( E ) Heat map representing normalized cytokine secretion post-treatment of one donor. ( F ) IP-10 and ( G ) IFNβ secretion was measured, and data represent the average of a triplicate from one donor. Data are representative of at least two donors. ( H ) Cells treated for 24 hours in the presence of cGAS∆N-LNPs were stained for activation markers. The MFI of CD40 expression was quantified by flow cytometry. Data represent the MFI for each of the two donors run in triplicate. Error bars show the standard deviation between donor surface marker expressions. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Activation Assay, Cell Culture, Multiplex Assay, Standard Deviation, Staining, Expressing, Flow Cytometry, Marker

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: mRNA sequence used

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Sequencing

Journal: Cell Death & Disease

Article Title: CMTR1 promotes colorectal cancer cell growth and immune evasion by transcriptionally regulating STAT3

doi: 10.1038/s41419-023-05767-3

Figure Lengend Snippet: A RNA-seq was conducted on RKO cells transfected with control siRNA (si-Ctrl) or CMTR1 siRNA (si-CMTR1). A pie chart was used to show genes positively and negatively regulated by CMTR1. B , C The expression levels of genes positively and negatively regulated by CMTR1 are displayed in a heatmap and a box plot. D Hallmark gene set analysis revealed the gene term with the greatest enrichment of genes positively regulated by CMTR1. E – G Graphical presentation of the effects of CMTR1 on representative cell cycle-related genes, such as CDKN1A, CDK6, and CCND1, as determined by RNA-seq. H – Q Expression of CDKN1A, CDK6, and CCND1, measured by RT‒qPCR and western blotting in CMTR1 knockdown and CMTR1-overexpressing cells. * P < 0.05, ** P < 0.01, and *** P < 0.001.

Article Snippet: For CMTR1 and STAT3 knockdown, siRNA targeting human CMTR1 and STAT3 mRNA sequences obtained from RiboBio Co., Ltd. (Guangzhou, China) were used.

Techniques: RNA Sequencing, Transfection, Control, Expressing, Western Blot, Knockdown

Journal: Cell Death & Disease

Article Title: CMTR1 promotes colorectal cancer cell growth and immune evasion by transcriptionally regulating STAT3

doi: 10.1038/s41419-023-05767-3

Figure Lengend Snippet: A Schematic diagram showing the time point of anti-PD1 antibody treatment and analysis of tissues from C57BL/6 J mice implanted with MC38 cells. B , C After the knockdown of CMTR1 expression using shRNA, the expression of CMTR1 was measured by RT‒qPCR and western blotting. D , E Representative pictures of MC38 cell-derived tumors in C57BL/6 J mice, and tumor weights indicating the effects of CMTR1 knockdown or in combination with PD1. F , G Immunohistochemical staining and semi-quantitative analysis of CD8 positive T cells in tumors from mice indicating the effects of CMTR1 knockdown alone or in combination with PD1 blockade therapy. Scale bar: 50 µm. H , I Immunofluorescent staining and quantification of ki67 in tumors from mice upon CMTR1 knockdown or in combination with PD1. Scale bar: 50 µm. J – M Relative mRNA levels of inflammatory mediators in tumors from mice treated as indicated. * P < 0.05, ** P < 0.01, and *** P < 0.001.

Article Snippet: For CMTR1 and STAT3 knockdown, siRNA targeting human CMTR1 and STAT3 mRNA sequences obtained from RiboBio Co., Ltd. (Guangzhou, China) were used.

Techniques: Knockdown, Expressing, shRNA, Western Blot, Derivative Assay, Immunohistochemical staining, Staining

Journal: International journal of oncology

Article Title: CCL25 mediates migration, invasion and matrix metalloproteinase expression by breast cancer cells in a CCR9-dependent fashion

doi: 10.3892/ijo.2011.953

Figure Lengend Snippet: CCR9 expression by breast cancer cell lines. (A) Total RNA was isolated from MCF-7 and MDA-MB-231 cell lines, and quantitative RT-PCR analysis of CCR9 mRNA expression was performed in triplicate. The copies of transcripts are expressed relative to actual copies of 18S rRNA ± SE. *Statistical significance (p<0.01) between normal tissue and BrCa cells. (B) MDA-MB-231 and MCF-7 cells were stained with FITC-conjugated isotype control antibodies (solid histogram) or anti-CCR9 monoclonal antibodies (open histogram) and quantified by flow cytometry. The mean fluorescent intensities (M) of CCR9-positive cells are shown.

Article Snippet: Primer design Human mRNA sequences for CCR9, MMP-1, MMP-2, MMP-3, MMP-9, MMP-10, MMP-11, MMP-13 and 18S rRNA were obtained from the National Institutes of Health National Center for Biotechnology Information GenBank database accession nos.

Techniques: Expressing, Isolation, Quantitative RT-PCR, Staining, Control, Bioprocessing, Flow Cytometry

Journal: International journal of oncology

Article Title: CCL25 mediates migration, invasion and matrix metalloproteinase expression by breast cancer cells in a CCR9-dependent fashion

doi: 10.3892/ijo.2011.953

Figure Lengend Snippet: CCL25-induced collagenase expression by breast cancer cells. Cells were tested for their ability to express collagenases (MMP-1 and MMP-13) mRNA and active protein. MDA-MB-231 cells were cultured for 24 h alone, with 100 ng/ml of CCL25 or CCL25 + 1.0 μg/ml of mouse anti-CCR9 antibody. Total RNA was isolated and quantitative RT-PCR analysis was performed for mRNA expression of MMPs and transcript copies are presented relative to actual copies of 18S rRNA. Active protein expression was quantified by Fluorokine and Biotrak assays in conditioned media. *Statistical differences (P<0.01) between untreated and CCL25-treated BrCa cells.

Article Snippet: Primer design Human mRNA sequences for CCR9, MMP-1, MMP-2, MMP-3, MMP-9, MMP-10, MMP-11, MMP-13 and 18S rRNA were obtained from the National Institutes of Health National Center for Biotechnology Information GenBank database accession nos.

Techniques: Expressing, Cell Culture, Isolation, Quantitative RT-PCR

Journal: International journal of oncology

Article Title: CCL25 mediates migration, invasion and matrix metalloproteinase expression by breast cancer cells in a CCR9-dependent fashion

doi: 10.3892/ijo.2011.953

Figure Lengend Snippet: CCL25-induced gelatinase expression by breast cancer cells. Cells were tested for their ability to express gelatinases (MMP-2 and MMP-9) mRNA and active protein. MDA-MB-231 cells were cultured for 24 h alone, with 100 ng/ml of CCL25 or CCL25 + 1.0 μg/ml of mouse anti-CCR9 antibody. Total RNA was isolated and quantitative RT-PCR analysis was performed for mRNA expression of MMPs and transcript copies are presented relative to actual copies of 18S rRNA. Active protein expression was quantified by Fluorokine and Biotrak assays in conditioned media. *Statistical differences (P<0.01) between untreated and CCL25-treated BrCa cells.

Article Snippet: Primer design Human mRNA sequences for CCR9, MMP-1, MMP-2, MMP-3, MMP-9, MMP-10, MMP-11, MMP-13 and 18S rRNA were obtained from the National Institutes of Health National Center for Biotechnology Information GenBank database accession nos.

Techniques: Expressing, Cell Culture, Isolation, Quantitative RT-PCR

Journal: International journal of oncology

Article Title: CCL25 mediates migration, invasion and matrix metalloproteinase expression by breast cancer cells in a CCR9-dependent fashion

doi: 10.3892/ijo.2011.953

Figure Lengend Snippet: CCL25-induced stromelysin expression by breast cancer cells. Cells were tested for their ability to express stromelysins (MMP-3, MMP-10 and MMP-11) mRNA and active protein. MDA-MB-231 cells were cultured for 24 h alone, with 100 ng/ml of CCL25 or CCL25 + 1.0 μg/ml of mouse anti-CCR9 antibody. Total RNA was isolated and quantitative RT-PCR analysis was performed for mRNA expression of MMPs and transcript copies are presented relative to actual copies of 18S rRNA. Active protein expression was quantified by Fluorokine and Biotrak assays in conditioned media. *Statistical differences (P<0.01) between untreated and CCL25-treated BrCa cells.

Article Snippet: Primer design Human mRNA sequences for CCR9, MMP-1, MMP-2, MMP-3, MMP-9, MMP-10, MMP-11, MMP-13 and 18S rRNA were obtained from the National Institutes of Health National Center for Biotechnology Information GenBank database accession nos.

Techniques: Expressing, Cell Culture, Isolation, Quantitative RT-PCR